circad | circRNAs associated with diseases

hsa_circ_0004491
Gene	ORC4	Organism	Human
Genome Locus	chr2:148730307-148739650:-	Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink	Link to database	PMID	31669576
Experimental Method
Sample Type	Tissues	Comparison	Forty paired samples of OSCC and adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGATCAGGAAAAACTATGGAAGCCTG Reverse GCCTTGACAGACAGACAGCA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Li, X, Zhang, H, Wang, Y, Sun, S, Shen, Y, Yang, H (2019). Silencing circular RNA hsa_circ_0004491 promotes metastasis of oral squamous cell carcinoma. Life Sci., 239:116883.